SubtiBank SubtiBank
hemC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

hemC

hydroxymethylbilane synthase
locus
BSU_28150
pI
5.09
mw
34.68 kDa
protein length
314 aa Sequence Blast
gene length
945 bp Sequence Blast
function
heme biosynthesis
product
hydroxymethylbilane synthase
essential
no
ec
2.5.1.61
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.6|Biosynthesis of heme/ siroheme]
  • Gene

    Coordinates
    2,875,951 → 2,876,895

    The protein

    Catalyzed reaction/ biological activity

  • H2O + 4 porphobilinogen --> hydroxymethylbilane + 4 NH4+ (according to UniProt)
  • Protein family

  • HMBS family (single member, according to UniProt)
  • Structure

  • [PDB|4MLQ] (from ''Bacillus megaterium'', 70% identity) [Pubmed|24598743]
  • Expression and Regulation

    Operons

    count
    2
    genes
    [gene|B1413EB525000744BE8E429E760220A13BC4530D|hemA]-[gene|88616BA1E853E11BE0CB18F06287CA4C68143148|hemX]-[gene|D266E22E07B849E2AEB0EF232C49A2FE1EA4E02B|hemC]-[gene|33459D4389F85D60311FCE770BBA0ED9802BA342|hemD]-[gene|70263A55987F110209367CF45AD65A584AD3077D|hemB]-[gene|A54B2C86638D474F5F892003B42C535B5B39A42E|hemL]
    description
    [Pubmed|1672867]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1672867], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|11532148], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced by hydrogen peroxide ([protein|search|PerR]) [Pubmed|11532148]
  • view in new tab

    Biological materials

    Mutant

  • BKE28150 (Δ[gene|D266E22E07B849E2AEB0EF232C49A2FE1EA4E02B|hemC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTTCCTCCCGAATC, downstream forward: _UP4_CGTGTAAAACGGGAGCTTGA
  • BKK28150 (Δ[gene|D266E22E07B849E2AEB0EF232C49A2FE1EA4E02B|hemC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTTCCTCCCGAATC, downstream forward: _UP4_CGTGTAAAACGGGAGCTTGA
  • References

    Reviews

  • 28123057
  • Original Publications

  • 10217486,1672867,11532148,24598743