SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional repressor of the SOS regulon
22.70 kDa
protein length
205 aa Sequence Blast
gene length
618 bp Sequence Blast
regulation of DNA damage repair
transcriptional repressor of the SOS regulon

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    1,917,639 → 1,918,256

    The protein

    Catalyzed reaction/ biological activity

  • Represses ''[gene|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|uvrB], [gene|DEB7605B4F6F5F365A49C1C15647F9767B01BF66|bstG], [gene|60344F56DEB167FA62C16E52E8238393CEE19312|tagC], [gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]'' genes and itself by binding to the 14 bp palindromic sequence 5'-CGAACNNNNGTTCG-3'. In the presence of single-stranded DNA, [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] interacts with [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA] causing an autocatalytic cleavage which disrupts the DNA-binding part of [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA], leading to derepression of the SOS regulon and eventually DNA repair (according to UniProt)
  • Hydrolysis of Ala-|-Gly bond in repressor LexA (according to UniProt)
  • Protein family

  • peptidase S24 family (single member, according to UniProt)
  • Structure

  • [PDB|1JHH] (from ''E. coli'', S119A mutant, 33% identity, 52% similarity) [Pubmed|11551506]
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|2548995], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR]: autorepression, in [regulon|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR regulon]
  • regulation

  • induced upon DNA damage ([protein|search|LexA]) [Pubmed|1657879,8899710,16267290]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|fosB]' and '[protein|search|lexA]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • BKE17850 (Δ[gene|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCGCACCTCAAAAC, downstream forward: _UP4_TAATCTATTGATCTATCAGA
  • BKK17850 (Δ[gene|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCGCACCTCAAAAC, downstream forward: _UP4_TAATCTATTGATCTATCAGA
  • References


  • 22933559,18726173
  • Original publications

  • 8899710,9045831,9555905,8969214,1657879,16267290,11551506,16549676,20525796,31530675