The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

lexA

transcriptional repressor of the SOS regulon

locus: BSU_17850

pI: 5.16

mw: 22.70 kDa

protein length: 205 aa

gene length: 618 bp

function: regulation of DNA damage repair

product: transcriptional repressor of the SOS regulon

essential: no

synonyms: dinR

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
• [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]

Gene

Coordinates: 1,917,639 → 1,918,256

The protein

Catalyzed reaction/ biological activity

• Represses ''[gene|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|uvrB], [gene|DEB7605B4F6F5F365A49C1C15647F9767B01BF66|bstG], [gene|60344F56DEB167FA62C16E52E8238393CEE19312|tagC], [gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]'' genes and itself by binding to the 14 bp palindromic sequence 5'-CGAACNNNNGTTCG-3'. In the presence of single-stranded DNA, [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] interacts with [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA] causing an autocatalytic cleavage which disrupts the DNA-binding part of [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA], leading to derepression of the SOS regulon and eventually DNA repair (according to UniProt)
• Hydrolysis of Ala-|-Gly bond in repressor LexA (according to UniProt)

Protein family

• peptidase S24 family (single member, according to UniProt)

Structure

• [PDB|1JHH] (from ''E. coli'', S119A mutant, 33% identity, 52% similarity) [Pubmed|11551506]

additional information

• information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000025 PRODORIC2 database]

Expression and Regulation

Operons

• genes: [gene|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]
  description: [Pubmed|1657879]

  regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|2548995], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR]: autorepression, in [regulon|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR regulon]

  regulation

  • induced upon DNA damage ([protein|search|LexA]) [Pubmed|1657879,8899710,16267290]

  additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|fosB]' and '[protein|search|lexA]' [PubMed|20525796]

Biological materials

Mutant

• BKE17850 (Δ[gene|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCGCACCTCAAAAC, downstream forward: _UP4_TAATCTATTGATCTATCAGA
• BKK17850 (Δ[gene|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCGCACCTCAAAAC, downstream forward: _UP4_TAATCTATTGATCTATCAGA

References

Reviews

• 22933559,18726173

Original publications

• 8899710,9045831,9555905,8969214,1657879,16267290,11551506,16549676,20525796,31530675