SubtiBank SubtiBank
lexA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lexA

transcriptional repressor of the SOS regulon
locus
BSU_17850
pI
5.16
mw
22.70 kDa
protein length
205 aa Sequence Blast
gene length
618 bp Sequence Blast
function
regulation of DNA damage repair
product
transcriptional repressor of the SOS regulon
essential
no
synonyms
dinR

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    1,917,639 → 1,918,256

    The protein

    Catalyzed reaction/ biological activity

  • Represses ''[gene|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|uvrB], [gene|DEB7605B4F6F5F365A49C1C15647F9767B01BF66|bstG], [gene|60344F56DEB167FA62C16E52E8238393CEE19312|tagC], [gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]'' genes and itself by binding to the 14 bp palindromic sequence 5'-CGAACNNNNGTTCG-3'. In the presence of single-stranded DNA, [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] interacts with [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA] causing an autocatalytic cleavage which disrupts the DNA-binding part of [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA], leading to derepression of the SOS regulon and eventually DNA repair (according to UniProt)
  • Hydrolysis of Ala-|-Gly bond in repressor LexA (according to UniProt)
  • Protein family

  • peptidase S24 family (single member, according to UniProt)
  • Structure

  • [PDB|1JHH] (from ''E. coli'', S119A mutant, 33% identity, 52% similarity) [Pubmed|11551506]
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000025 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]
    description
    [Pubmed|1657879]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|2548995], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR]: autorepression, in [regulon|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR regulon]
  • regulation

  • induced upon DNA damage ([protein|search|LexA]) [Pubmed|1657879,8899710,16267290]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|fosB]' and '[protein|search|lexA]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE17850 (Δ[gene|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCGCACCTCAAAAC, downstream forward: _UP4_TAATCTATTGATCTATCAGA
  • BKK17850 (Δ[gene|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCGCACCTCAAAAC, downstream forward: _UP4_TAATCTATTGATCTATCAGA
  • References

    Reviews

  • 22933559,18726173
  • Original publications

  • 8899710,9045831,9555905,8969214,1657879,16267290,11551506,16549676,20525796