SubtiBank SubtiBank
ycgK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycgK

similar to transcriptional regulator ([SW|LysR family])
locus
BSU_03170
pI
7.28
mw
36.25 kDa
protein length
324 aa Sequence Blast
gene length
975 bp Sequence Blast
function
unknown
product
transcriptional regulator ([SW|LysR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    341,492 → 342,466

    The protein

    Protein family

  • [SW|LysR family] (according to UniProt)
  • [SW|Domains]

  • [SW|HTH lysR-type domain] (aa 1-58) (according to UniProt)
  • Structure

  • [PDB|4X6G] (from Pseudomonas aeruginosa, 29% identity) [pubmed|25931525]
  • Expression and Regulation

    Operons

    genes
    [gene|D28190620D5B834DD7F42822B835C6FE932FD8A5|ycgK]-[gene|6BCE78F623A40B519211E79AFA1AD898318BD817|cah]-[gene|7306A55192AEB4032FD17A1BAAFF1127D511D70E|ycgL]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B990 (ycgK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1989 NBRP B. subtilis, Japan]
  • BKE03170 (Δ[gene|D28190620D5B834DD7F42822B835C6FE932FD8A5|ycgK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAGCCTCCATAGGTT, downstream forward: _UP4_TAGAAAACAAAGACGAAACG
  • BKK03170 (Δ[gene|D28190620D5B834DD7F42822B835C6FE932FD8A5|ycgK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAGCCTCCATAGGTT, downstream forward: _UP4_TAGAAAACAAAGACGAAACG
  • References

    Research papers

  • 25931525