SubtiBank SubtiBank
ycgK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycgK

similar to transcriptional regulator ([SW|LysR family])
locus
BSU_03170
pI
7.28
mw
36.25 kDa
protein length
324 aa Sequence Blast
gene length
975 bp Sequence Blast
function
unknown
product
transcriptional regulator ([SW|LysR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    341,492 → 342,466

    The protein

    Protein family

  • [SW|LysR family] (according to UniProt)
  • Structure

  • [PDB|4X6G] (from Pseudomonas aeruginosa, 29% identity) [pubmed|25931525]
  • Expression and Regulation

    Operons

    genes
    [gene|D28190620D5B834DD7F42822B835C6FE932FD8A5|ycgK]-[gene|6BCE78F623A40B519211E79AFA1AD898318BD817|cah]-[gene|7306A55192AEB4032FD17A1BAAFF1127D511D70E|ycgL]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B990 (ycgK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1989 NBRP B. subtilis, Japan]
  • BKE03170 (Δ[gene|D28190620D5B834DD7F42822B835C6FE932FD8A5|ycgK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAGCCTCCATAGGTT, downstream forward: _UP4_TAGAAAACAAAGACGAAACG
  • BKK03170 (Δ[gene|D28190620D5B834DD7F42822B835C6FE932FD8A5|ycgK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAGCCTCCATAGGTT, downstream forward: _UP4_TAGAAAACAAAGACGAAACG
  • References

    Research papers

  • 25931525