SubtiBank SubtiBank
yyzN
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yyzN

unknown
locus
BSU_40139
pI
9.60
mw
6.20 kDa
protein length
gene length
159 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,123,931 → 4,124,089

    Expression and Regulation

    Operons

    genes
    [gene|59EBB1812BA939110BC00ACE30057AB987E61B30|yydK]-[gene|D29C8EF4F415C68A90DF693AB1AC12537CE87298|yyzN]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE40139 (Δ[gene|D29C8EF4F415C68A90DF693AB1AC12537CE87298|yyzN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40139 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGACCACCTACCGTA, downstream forward: _UP4_TAATAGTTTGGGCGATGCAA
  • BKK40139 (Δ[gene|D29C8EF4F415C68A90DF693AB1AC12537CE87298|yyzN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40139 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGACCACCTACCGTA, downstream forward: _UP4_TAATAGTTTGGGCGATGCAA