SubtiBank SubtiBank
yeeK
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yeeK

inner spore coat protein
locus
BSU_06850
pI
6.85
mw
15.78 kDa
protein length
145 aa Sequence Blast
gene length
438 bp Sequence Blast
function
protection of the spore
product
spore coat protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.5|Class V]
  • Gene

    Coordinates
    753,265 → 753,702

    The protein

    [SW|Localization]

  • inner spore coat [Pubmed|19933362], assembles into the spore integument [Pubmed|19060142]
  • localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814]
  • Additional information

  • [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE], [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA], and [protein|6698BB092E03BEF48AFD0CBF565410109CD1ABB5|SpoVID] are required for proper localization, clolocalizes with [protein|A46D07F8F56249A04C5F880120D19F00C9CAE112|YabG] [Pubmed|19060142]
  • Expression and Regulation

    Operons

    genes
    [gene|D2A0A4793350632217F4425EB6F459B538067CD7|yeeK]
    description
    [Pubmed|19060142]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,19060142], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|19060142], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expression starts 5 hrs after the onset of [SW|sporulation] ([protein|search|SigK], [protein|search|GerE]) [Pubmed|19060142]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A953 (yeeK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/953 NBRP B. subtilis, Japan]
  • 1S125 ( ''yeeK''::''erm''), [Pubmed|16751597], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S125&Search=1S125 BGSC]
  • BKE06850 (Δ[gene|D2A0A4793350632217F4425EB6F459B538067CD7|yeeK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTACTCTCTCCTTCA, downstream forward: _UP4_TAAAGAAGATGATGATAAAA
  • BKK06850 (Δ[gene|D2A0A4793350632217F4425EB6F459B538067CD7|yeeK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTACTCTCTCCTTCA, downstream forward: _UP4_TAAAGAAGATGATGATAAAA
  • References

  • 10714992,19933362,19060142,22171814,30958830