The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybdG

unknown

locus: BSU_01990

pI: 9.62

mw: 33.34 kDa

protein length: 325 aa

gene length: 978 bp

function: unknown

product: unknown

essential: no

synonyms

Genomic Context

categories

• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
• [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]

Gene

Coordinates: 220,279 → 221,256

The protein

[SW|Domains]

• [SW|AB hydrolase-1 domain] (aa 94-166) (according to UniProt)

[SW|Localization]

• cell membrane (according to UniProt)

Biological materials

Mutant

• MGNA-B955 (ybdG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1954 NBRP B. subtilis, Japan]
• BKE01990 (Δ[gene|D2B8AD67EE5BA898802B4792EB2A120B99456AD1|ybdG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGATGCTCCTTTCACT, downstream forward: _UP4_GAGTTTATGAGAAAGGTTCG
• BKK01990 (Δ[gene|D2B8AD67EE5BA898802B4792EB2A120B99456AD1|ybdG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGATGCTCCTTTCACT, downstream forward: _UP4_GAGTTTATGAGAAAGGTTCG