SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


L-aspartate oxidase
58.07 kDa
protein length
531 aa Sequence Blast
gene length
1596 bp Sequence Blast
NAD biosynthesis
L-aspartate oxidase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of NAD(P)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,847,871 → 2,849,466

    The protein

    Catalyzed reaction/ biological activity

  • L-aspartate + O2 --> H2O2 + iminosuccinate (according to UniProt)
  • Protein family

  • FAD-dependent oxidoreductase 2 family (with [protein|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|SdhA], according to UniProt)
  • Modification

  • phosphorylated on Arg-104 [Pubmed|22517742]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|5KXJ] (from Salmonella typhimurium, 38% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8444804], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|510DE075EA964D22C42DEB171509F6CDA600A402|NadR]: repression, [Pubmed|16199587], in [regulon|510DE075EA964D22C42DEB171509F6CDA600A402|NadR regulon]
  • regulation

  • repressed in the presence of nicotinic acid ([protein|search|NadR]) [Pubmed|16199587]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|nadB]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • BKE27870 (Δ[gene|D30D059185DFB828AB0FD07D600DBC3FD0973198|nadB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGCCATCCTCCTGTTG, downstream forward: _UP4_AGAAAAAACGAGGGGATTTG
  • BKK27870 (Δ[gene|D30D059185DFB828AB0FD07D600DBC3FD0973198|nadB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGCCATCCTCCTGTTG, downstream forward: _UP4_AGAAAAAACGAGGGGATTTG
  • labs

  • [SW|Alessandra Albertini], University of Pavia, Italy [ homepage]
  • References

  • 8444804,18959769,16199587,20525796,22517742