SubtiBank SubtiBank
comGD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

comGD

DNA transport machinery, minor pseudopilin
locus
BSU_24700
pI
9.88
mw
15.87 kDa
protein length
143 aa Sequence Blast
gene length
432 bp Sequence Blast
function
genetic competence, DNA uptake
product
minor pseudopilin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,557,252 → 2,557,683

    The protein

    [SW|Localization]

  • associated to the membrane via [protein|89442BFDFBFF264D0C7F12DEA6F8130C55D1F3F8|ComGG] [Pubmed|24164455]
  • cell surface [Pubmed|9723928]
  • Expression and Regulation

    Operons

    genes
    [gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]-[gene|EA1C841FC77A1994A85E2E0C0A554482C3EC9323|comGB]-[gene|19D76B80386F825109C5FB4A34881D5D20F366DB|comGC]-[gene|D323AEF5AFB4FD2A074ABAB76A39BE26A4C6436F|comGD]-[gene|FF4DB7FDCEB440064E11E65CB0DBFB93FC785CF0|comGE]-[gene|DD266DC0D78B5C5E82EED7CC7F55D0CF8FB4BF7A|comGF]-[gene|89442BFDFBFF264D0C7F12DEA6F8130C55D1F3F8|comGG]-[gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL]
    description
    [Pubmed|26735940,2507524]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2507524], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|26735940], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8196543], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|26735940]
  • additional information

  • the ''[SW|comGA]-[SW|comGB]-[SW|comGC]-[SW|comGD]-[SW|comGE]-[SW|comGF]-[SW|comGG]-[protein|search|spoIIIL]'' operon requires [SW|NusA] for expression [http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    Biological materials

    Mutant

  • BKE24700 (Δ[gene|D323AEF5AFB4FD2A074ABAB76A39BE26A4C6436F|comGD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTTAATGTTCAACCTTAAC, downstream forward: _UP4_GTCAATGTGGAGAGAAAATA
  • BKK24700 (Δ[gene|D323AEF5AFB4FD2A074ABAB76A39BE26A4C6436F|comGD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTTAATGTTCAACCTTAAC, downstream forward: _UP4_GTCAATGTGGAGAGAAAATA
  • BP914 (Δ([gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]-[gene|EA1C841FC77A1994A85E2E0C0A554482C3EC9323|comGB]-[gene|19D76B80386F825109C5FB4A34881D5D20F366DB|comGC]-[gene|D323AEF5AFB4FD2A074ABAB76A39BE26A4C6436F|comGD]-[gene|FF4DB7FDCEB440064E11E65CB0DBFB93FC785CF0|comGE]-[gene|DD266DC0D78B5C5E82EED7CC7F55D0CF8FB4BF7A|comGF]-[gene|89442BFDFBFF264D0C7F12DEA6F8130C55D1F3F8|comGG])::phleo), available in [SW|Fabian Commichau]'s lab
  • References

    Reviews

  • 15083159
  • Original publications

  • 9422590,9723928,11814663,12107147,2507524,8196543,24164455