SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


high-affinity [SW|ABC transporter] for zinc (binding protein, lipoprotein)
35.51 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
zinc uptake
[SW|ABC transporter] for zinc (binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of ions]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW|Zinc]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    308,332 → 309,291

    Phenotypes of a mutant

  • reduced genetic competence, can be rescued by the addition of excess zinc [Pubmed|21813502]
  • reduced expression of the ''[gene|45F27C0789199626BA90D2C69E8F13525C911478|comFA]-[gene|D290247A43280532947B707F3AF388D7A7F404D3|comFB]-[gene|04D9D70C0BCFDCBD00B5156908C348135080A9C2|comFC]-[gene|049B1EBF64F0EBC04CE6D529C8EDB0B6B2184DF5|yvyF]-[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]'' operon [Pubmed|21813502]
  • The protein

    Protein family

  • bacterial solute-binding protein 9 family (with [protein|3C40A6E42A669E77ADBF5FFF334061C51F76A4F9|MntA], according to UniProt)
  • Paralogous protein(s)

  • [protein|3C40A6E42A669E77ADBF5FFF334061C51F76A4F9|MntA]
  • Structure

  • [PDB|2O1E]
  • [SW|Localization]

  • inner spore membrane [Pubmed|30602489,26731423]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12426338], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]: repression, in the presence of zinc [Pubmed|12426338], in [regulon|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur regulon]
  • regulation

  • induced by zinc starvation ([protein|search|Zur]) [Pubmed|12426338]
  • view in new tab

    Biological materials


  • BKE02850 (Δ[gene|D33A144568CAF32FFE4A2A46BE67573DB66FC1A1|znuA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTATATCCCCTCTT, downstream forward: _UP4_TAAGATAGTGTGCGCCGGAG
  • BKK02850 (Δ[gene|D33A144568CAF32FFE4A2A46BE67573DB66FC1A1|znuA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTATATCCCCTCTT, downstream forward: _UP4_TAAGATAGTGTGCGCCGGAG
  • References

  • 12426338,9811636,10092453,21813502,12426338,18957862,18763711,26731423,27561249,30602489