SubtiBank SubtiBank
purL
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

purL

phosphoribosylformylglycinamidine synthase
locus
BSU_06480
pI
4.55
mw
80.10 kDa
protein length
742 aa Sequence Blast
gene length
2229 bp Sequence Blast
function
purine biosynthesis
product
phosphoribosylformylglycinamidine synthase
essential
no
ec
6.3.5.3
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    703,237 → 705,465

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O + L-glutamine + N2-formyl-N1-(5-phospho-D-ribosyl)glycinamide --> 2-(formamido)-N1-(5-phospho-D-ribosyl)acetamidine + ADP + H+ + L-glutamate + phosphate(according to UniProt)
  • H2O + L-glutamine --> L-glutamate + NH4+ (according to UniProt)
  • Protein family

  • FGAMS family (single member, according to UniProt)
  • Structure

  • [PDB|3D54] (from ''Thermotoga maritima'', 39% identity, 58% similarity) [Pubmed|18597481]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • membrane associated [Pubmed|18763711]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]-[gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]-[gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]-[gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]-[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]-[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]-[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]-[gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]-[gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]-[gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]-[gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]-[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]
    description
    [Pubmed|3036807]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • BKE06480 (Δ[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCAAGCAGTAGTGACATG, downstream forward: _UP4_CCATGCTTGCTGAAATCAAA
  • BKK06480 (Δ[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCAAGCAGTAGTGACATG, downstream forward: _UP4_CCATGCTTGCTGAAATCAAA
  • References

  • 15301530,3036807,12923093,21671997,7638212,18763711,15378759