SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


two-component response regulator, regulation of degradative enzyme expression, [SW|genetic competence], [SW|biofilm formation], capsule biosynthesis (together with [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]), non-phosphorylated DegU is required for swarming motility
25.72 kDa
protein length
229 aa Sequence Blast
gene length
690 bp Sequence Blast
regulation of degradative enzymes, [SW|genetic competence], and other adaptive responses
two-component response regulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Regulation]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    3,644,607 → 3,645,296

    Phenotypes of a mutant

  • defect in [SW|biofilm formation] [Pubmed|20815827], this can be suppressed by [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-independent expression of [protein|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|BslA] [Pubmed|21742882]
  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants due to reduced expression of the [gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE] operon [Pubmed|24296669]
  • The protein

    Catalyzed reaction/ biological activity

  • transcription activator and repressor (see [SW|DegU regulon])
  • DegU-P represses expression of the fla/che operon (''[gene|1C6C8DB02E10EAC0588389D9F0D3AF3E19172C5C|flgB]-[gene|CC423DE6481353699B0CD3A2B8BBC36967A832CC|flgC]-[gene|7E8F88F7A9CAD4ED0927CDC6AAFDEDC08197C709|fliE]-[gene|EB815705133E3318F655F6024B7D9BA587FD1DDA|fliF]-[gene|8DDCC3D139ACCB635BF014946E1282A72D535390|fliG]-[gene|4D8CF3BED8F94DE3F8FCDEB1FE55D5F1D17FE26F|fliH]-[gene|401459F105BC8A8342341D953AE259D6C3868AB6|fliI]-[gene|600DECF2BE9ADCAB87E53790CE4F0D61F8B3F7CC|fliJ]-[gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]-[gene|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK]-[gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]-[gene|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|flgE]-[gene|2CCB8AD9238D18BA2361020A671844C021E81EE0|fliL]-[gene|1D51AF3E6456F126203D7C7273FB828A47E26DFB|fliM]-[gene|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|fliY]-[gene|2F0495C7EAB81BDB1F3181677C555537BD2A972F|cheY]-[gene|C2C67880EDF09E1BA75A4791628EE1982F9B6B0B|fliZ]-[gene|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|fliP]-[gene|A3C07B70C87D671979D053A6272A0FCDED6F3BB7|fliQ]-[gene|9856F25F23264AD1402A85AE9E25F10B68CAD739|fliR]-[gene|68DB2871A88535714C84FE86006AB54CEB6F0EAD|flhB]-[gene|974FA844E263AA694477992FA50468CB8EFAB807|flhA]-[gene|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|flhF]-[gene|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|flhG]-[gene|B0415A8CD040EC714B54F4038E065B3E1E20A271|cheB]-[gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]-[gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]-[gene|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC]-[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]-[gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]'') in the absence of [protein|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|SwrAA/2], and switches to an activator of the operon in the presence of [protein|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|SwrAA/2] [Pubmed|24386445]
  • Modification

  • phosphorylated by [protein|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|DegS] on Asp-56 [Pubmed|1901568], this modulates DNA-binding activity
  • phosphorylation by [protein|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|DegS] occurs in response to inhibition of flagellar rotation [Pubmed|28800172,23888912]
  • Effectors of protein activity

  • DNA-binding activity of DegU is inhibited by [protein|E1744329B6489F989F93F3E71E51E772E3926ABF|RapG] [Pubmed|12950930]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P is degraded by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [Pubmed|20070525]
  • Structure

  • [PDB|4GVP] (VraR from ''Staphylococcus aureus'', 35% identity) [Pubmed|23650349]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P is degraded by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [Pubmed|20070525]
  • accumulation of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P results in decreased transcription of the [gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO] and [gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]-[gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA] operons due to increased levels of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]-P [Pubmed|24123822]
  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1688843], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|18502860], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: activation, [Pubmed|23123903], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|24317403], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • regulation

  • induced by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|23123903]
  • view in new tab



  • induced by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|23123903]
  • view in new tab

    Biological materials


  • GP2644([gene|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • BKE35490 (Δ[gene|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAGCCACGCCTCCTTGT, downstream forward: _UP4_TAGTATAATAGGAGACTTGC
  • BKK35490 (Δ[gene|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAGCCACGCCTCCTTGT, downstream forward: _UP4_TAGTATAATAGGAGACTTGC
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References


  • 20030732,19118340,23927648,24988880
  • The [SW|DegU regulon]

  • 12471443
  • Original Publications

  • 17850253,8878039,14563871,1901568,1321152,1459944,18194340,18978066,10908654,18502860,10094672,19389763,20815827,21742882,18414485,19420703,2428811,7746142,18502860,19389763,19416356,19734658,1688843,20070525,18197985,15598897,12950930,17590234,8955341,22496484,22745669,23123903,21965392,24123822,24296669,122328658,23888912,24149708,24317403,25431404,25433860,24386445,25777015,25880922,25887289,25755103,26819068, 23650349,27026185,27920766,28800172,29124898