SubtiBank SubtiBank
tseB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

tseB

tetracycline sensitivity suppressor of [gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA]
locus
BSU_22380
pI
9.24
mw
17.75 kDa
protein length
161 aa Sequence Blast
gene length
486 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ypmB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,348,864 → 2,349,349

    Phenotypes of a mutant

  • resistant to moenomycin [pubmed|29995990]
  • The protein

    Structure

  • [PDB|2GU3]
  • [SW|Localization]

  • cell membrane(according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|08F907C6F47BDEB4DC9A9F136CDC6A4063AC0140|ypmA]-[gene|D3629004F3B54D11566AE15227174F9EB7784201|tseB]-[gene|AE802E1D4F827DED3A5D953C7D034E6A3554C45F|aspB]
    description
    [Pubmed|29995990,22383849]
    view in new tab

    genes
    [gene|D3629004F3B54D11566AE15227174F9EB7784201|tseB]-[gene|AE802E1D4F827DED3A5D953C7D034E6A3554C45F|aspB]
    description
    [Pubmed|22383849]

    regulation

  • constitutive
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A441 (ypmB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/441 NBRP B. subtilis, Japan]
  • BKE22380 (Δ[gene|D3629004F3B54D11566AE15227174F9EB7784201|tseB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTTTTTTTCTCATCTTCT, downstream forward: _UP4_TAAGACGAATTAGGGGGAGT
  • BKK22380 (Δ[gene|D3629004F3B54D11566AE15227174F9EB7784201|tseB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTTTTTTTCTCATCTTCT, downstream forward: _UP4_TAAGACGAATTAGGGGGAGT
  • References

  • 25954268,29995990