SubtiBank SubtiBank
yeeA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yeeA

similar to restriction-modification enzyme
locus
BSU_06760
pI
5.67
mw
100.96 kDa
protein length
879 aa Sequence Blast
gene length
2640 bp Sequence Blast
function
unknown
product
putative restriction-modification enzyme
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.4|DNA restriction/ modification]
  • Gene

    Coordinates
    740,288 → 742,927

    The protein

    Structure

  • [PDB|5HR4] (from Methylophilus methylotrophus, 38% identity) [pubmed|27082731]
  • Expression and Regulation

    Operons

    genes
    [gene|943294ACA74067A8549056699E08DF5B82337976|dgkB]-[gene|B97ABE3233A27A7C8273ED9A1E688247DD37FD12|rlmCD]-[gene|5B5014A68D777DB79179904D5FD3D14DEE0BF1F4|yefC]-[gene|D3F00747006D974A8635D4391E0C261A3276E6AB|yeeA]-[gene|2E55D086DD5023B98929FB8B61238C00E66B8BCB|yeeB]-[gene|DB1AAC91947A6008F631266E5CC85B58703AFD9D|yeeC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A959 (yeeA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/959 NBRP B. subtilis, Japan]
  • BKE06760 (Δ[gene|D3F00747006D974A8635D4391E0C261A3276E6AB|yeeA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCGTTTCCCCCATTAA, downstream forward: _UP4_ACAGAACGGTAGGTGTAAGG
  • BKK06760 (Δ[gene|D3F00747006D974A8635D4391E0C261A3276E6AB|yeeA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCGTTTCCCCCATTAA, downstream forward: _UP4_ACAGAACGGTAGGTGTAAGG
  • References

    Research papers

  • 27082731