SubtiBank SubtiBank
natR
The papers of the month are back! Check them out! Link here

natR

two-component response regulator, regulation of the [gene|B019FD0CB6F76C03DA5E76ABD1B324BA5E1A6936|natA]-[gene|search|natB ]operon
locus
BSU02740
pI
6.61
mw
26.82 kDa
protein length
233 aa Sequence Blast
gene length
699 bp Sequence Blast
function
regulation of the [gene|B019FD0CB6F76C03DA5E76ABD1B324BA5E1A6936|natA]-[gene|search|natB ]operon
product
two-component response regulator
essential
no
synonyms
yccH

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.2|Sodium uptake/ export]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.1|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    295,584 → 296,285

    The protein

    Protein family

  • OmpR family of two-component response regulators
  • Modification

  • phosphorylated by [protein|A4644CB18F7D0DF3E7E50ABB0C0F224D5744A1A5|NatK] on an Asp residue
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000232 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|D3F6337B94A633730E514B05CA852BE9AA3741B3|natR]-[gene|A4644CB18F7D0DF3E7E50ABB0C0F224D5744A1A5|natK]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C043 (yccH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2041 NBRP B. subtilis, Japan]
  • BKE02740 (Δ[gene|D3F6337B94A633730E514B05CA852BE9AA3741B3|natR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATCATTCCCCTAGTTA, downstream forward: _UP4_TACTATTTTTGAGGAGTTTA
  • BKK02740 (Δ[gene|D3F6337B94A633730E514B05CA852BE9AA3741B3|natR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATCATTCCCCTAGTTA, downstream forward: _UP4_TACTATTTTTGAGGAGTTTA
  • References

  • 10094672,17322186