SubtiBank SubtiBank
yrrO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrrO

tRNA uridine hydroxylase (in complex with [protein|A3EC327DA14F188E88AF4221B51EE5950F882277|YrrN])
locus
BSU_27340
pI
4.85
mw
47.46 kDa
protein length
422 aa Sequence Blast
gene length
1269 bp Sequence Blast
function
introduction of 5-methoxyuridine modification in tRNA (U34)
product
tRNA uridine hydroxylase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    2,792,860 → 2,794,128

    Phenotypes of a mutant

  • 50% reduction in mo5U tRNA levels [pubmed|31358606]
  • The protein

    Catalyzed reaction/ biological activity

  • hydroxylation of U34 in tRNA to give 5-hydroxyuridine (ho5U) (in complex with [protein|A3EC327DA14F188E88AF4221B51EE5950F882277|YrrN]) with prephenate as hydroxyl donor, ho5U is the precursor for 5-methoxyuridine modification (by [protein|CE4F2965077F2A5882432D683520E09B70B9369A|TrmR]) [pubmed|31358606]
  • Protein family

  • peptidase U32 family (with [protein|A3EC327DA14F188E88AF4221B51EE5950F882277|YrrN], according to UniProt)
  • Paralogous protein(s)

  • [protein|A3EC327DA14F188E88AF4221B51EE5950F882277|YrrN]
  • Expression and Regulation

    Operons

    genes
    [gene|CE4F2965077F2A5882432D683520E09B70B9369A|trmR]-[gene|A3EC327DA14F188E88AF4221B51EE5950F882277|yrrN]-[gene|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|yrrO]-[gene|A659D9894E777D8A99707CB750DF2918AEE06CE9|udk]-[gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A007 (yrrO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/7 NBRP B. subtilis, Japan]
  • BKE27340 (Δ[gene|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|yrrO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTAACCTCCTTTTG, downstream forward: _UP4_ATGAGAAAGGGGAAGTAACA
  • BKK27340 (Δ[gene|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|yrrO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTAACCTCCTTTTG, downstream forward: _UP4_ATGAGAAAGGGGAAGTAACA
  • References

    Research papers

  • 31358606