SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


Sec-independent membrane protein translocase, essential for [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG] activity at stage III, involved in the assembly of the [protein|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|SpoIIIAH]-[protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] complex
29.37 kDa
protein length
261 aa Sequence Blast
gene length
783 bp Sequence Blast
membrane insertion of proteins and [SW|protein secretion]
membrane protein translocase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    4,213,823 → 4,214,608

    The protein

    Catalyzed reaction/ biological activity

  • membrane protein translocase, facilitates insertion of [protein|9D4AE9AE191BFA82791549852782DC1B959A6897|SpoIIIAE] into the membrane [Pubmed|18485064]
  • Protein family

  • YidC/Oxa1/Alb3 family [Pubmed|20800571,21194367,15802250]
  • Paralogous protein(s)

  • [protein|121A9543F5BC1CBE77D85A34099DE09F8AC63E9F|YidC2]:
  • Structure

  • [PDB|3WO6] (from ''Bacillus halodurans'', 51% identity) [Pubmed|24739968]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation


    view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1487728], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|jag]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • BKE41040 (Δ[gene|D40C202E67A5319A91811DB11356F47A56C97DD2|spoIIIJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCCTATAATTAAT, downstream forward: _UP4_AAGTGAGGAATGTGACTGCT
  • BKK41040 (Δ[gene|D40C202E67A5319A91811DB11356F47A56C97DD2|spoIIIJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCCTATAATTAAT, downstream forward: _UP4_AAGTGAGGAATGTGACTGCT
  • Labs working on this gene/protein

  • [SW|Richard Losick], Harvard University, Cambridge, USA [ homepage]
  • [SW|Adriano Henriques], Lisbon, Portugal [ homepage]
  • References


  • 22688815,20800571,21194367,15802250,25947384,27879020
  • Original publications

  • 18485064,12813085,18820020,1487728,23852076,18763711,17114254,11889108,15995216,12586834,19717609,19779460,22864117,24443530,25133632,25313395,25359772,25855636,26331454,24739968