SubtiBank SubtiBank
ganS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ganS

galactotriose [SW|ABC transporter], binding protein
locus
BSU_34160
pI
5.44
mw
45.38 kDa
protein length
421 aa Sequence Blast
gene length
1266 bp Sequence Blast
function
uptake of galactotriose
product
galactotriose [SW|ABC transporter], binding protein
essential
no
synonyms
yvfK

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.24|Utilization of galactan]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,507,253 → 3,508,518

    Phenotypes of a mutant

  • a ''[gene|D4A5A878F87EBC14C02824233155CEBACEB41343|ganS]-[gene|75B1FD4AA7612B3B600CB0CE35319A6960536095|ganP]-[gene|676932E7DF143DC9AAAF1F415FB3D14EE25B2C2F|ganQ]-[gene|DBBA549C2D71CF628E92AC7B659EA276E227D742|ganA]-[gene|9DDEF5682B2D145830F33C7A1D5A6EC8527BB405|ganB]'' mutant is impaired in the utilization of galactan [Pubmed|22893383]
  • The protein

    Protein family

  • [SW|Bacterial solute-binding protein 1 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|5771E1976D986638B13ADDE97EDE32709E355923|MdxE]
  • Structure

  • [PDB|2ZYK] (from Thermoactinomyces vulgaris, 38% identity) [pubmed|17371546]
  • [SW|Localization]

  • cell membrane (via [protein|75B1FD4AA7612B3B600CB0CE35319A6960536095|GanP]-[protein|676932E7DF143DC9AAAF1F415FB3D14EE25B2C2F|GanQ]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|D4A5A878F87EBC14C02824233155CEBACEB41343|ganS]-[gene|75B1FD4AA7612B3B600CB0CE35319A6960536095|ganP]-[gene|676932E7DF143DC9AAAF1F415FB3D14EE25B2C2F|ganQ]-[gene|DBBA549C2D71CF628E92AC7B659EA276E227D742|ganA]-[gene|9DDEF5682B2D145830F33C7A1D5A6EC8527BB405|ganB]
    description
    [Pubmed|9287030]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|27501980], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1F787F70C87DEB221709579122D63C2322A84E56|GanR]: repression, [Pubmed|9287030], in [regulon|1F787F70C87DEB221709579122D63C2322A84E56|GanR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|28617843], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galactan (binding of galactobiose to [protein|1F787F70C87DEB221709579122D63C2322A84E56|GanR]) [Pubmed|28617843,27501980]
  • repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|28617843,27501980]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A484 (yvfK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/484 NBRP B. subtilis, Japan]
  • BKE34160 (Δ[gene|D4A5A878F87EBC14C02824233155CEBACEB41343|ganS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATTGTCACCCTTTCG, downstream forward: _UP4_TAAAGAGAAAGCTAGATTTG
  • BKK34160 (Δ[gene|D4A5A878F87EBC14C02824233155CEBACEB41343|ganS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATTGTCACCCTTTCG, downstream forward: _UP4_TAAAGAGAAAGCTAGATTTG
  • References

  • 11682178,10092453,9287030,22893383,27501980,17371546