SubtiBank SubtiBank
pheA
The papers of the month are back! Check them out! Link here

pheA

prephenate dehydratase
locus
BSU27900
pI
5.89
mw
31.75 kDa
protein length
285 aa Sequence Blast
gene length
855 bp Sequence Blast
function
biosynthesis of phenylalanine
product
prephenate dehydratase
essential
no
ec
4.2.1.51
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    Coordinates
    2,851,283 → 2,852,140

    The protein

    Catalyzed reaction/ biological activity

  • Prephenate = phenylpyruvate + H2O + CO2 (according to Swiss-Prot)
  • Effectors of protein activity

  • subject to feedback inhibtion by phenylalanine [Pubmed|4956345]
  • Structure

  • [PDB|4LUB] (from ''Streptococcus mutans'', 42% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|29D91115BB3AC03538D618E54A5A57F92777EFF6|spo0B]-[gene|84E7D672DB40B114DC4D96A4D8834958B47401A7|obg]-[gene|A4B7CF7A1C704C750AFAD97A43AF975260935083|thrR]-[gene|D4CCF6727AAC048792E59717E588C36EB617249D|pheA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2537815], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • expression is repressed by binding of [SW|RpoE] to the A-rich sequence in the -35 region of the promoter [Pubmed|27679485]
  • view in new tab

    Biological materials

    Mutant

  • 1A617 ( ''pheA''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A617&Search=1A617 BGSC]
  • BKE27900 (Δ[gene|D4CCF6727AAC048792E59717E588C36EB617249D|pheA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACTTTCATGACGATTTTCT, downstream forward: _UP4_TAAAAAAAGCCCACTAGAGG
  • BKK27900 (Δ[gene|D4CCF6727AAC048792E59717E588C36EB617249D|pheA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACTTTCATGACGATTTTCT, downstream forward: _UP4_TAAAAAAAGCCCACTAGAGG
  • References

  • 19258532,2537815,4956345