SubtiBank SubtiBank
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website


similar to cation efflux system
31.33 kDa
protein length
290 aa Sequence Blast
gene length
873 bp Sequence Blast

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    506,866 → 507,738

    The protein

    Protein family

  • [SW|Cation diffusion facilitator (CDF) transporter (TC 2.A.4) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|72BF9B934CB5800E156263FF377DED0AD2E920A9|MneS], [protein|28C7CFE5701F6920652BE1973DC7A15D7C088E35|MneP]
  • Structure

  • [PDB|5VRF] (from Shewanella oneidensis, 26% identity) [pubmed|29507252]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C120 (ydbO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE04540 (Δ[gene|D52111E81E9233DABAEFCAF6217145CF6A7F3961|ydbO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAATACCAGCCTCCAT, downstream forward: _UP4_ATAAAATAAGGCTGTTTAAC
  • BKK04540 (Δ[gene|D52111E81E9233DABAEFCAF6217145CF6A7F3961|ydbO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAATACCAGCCTCCAT, downstream forward: _UP4_ATAAAATAAGGCTGTTTAAC
  • References

    Research papers

  • 29507252