SubtiBank SubtiBank
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.


RNase HII, endoribonuclease, responsible for removal of single rNMPs incorporated into DNA by DNA polymerase during DNA replication
28.20 kDa
protein length
255 aa Sequence Blast
gene length
765 bp Sequence Blast
endonucleolytic cleavage of RNA in RNA-DNA hybrid molecules

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.1|DNA replication]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW|Endoribonucleases]
  • Gene

    1,677,451 → 1,678,218

    Phenotypes of a mutant

  • increased mutation rate [Pubmed|23882084], strand- and sequence-context–dependent GC → AT transitions [pubmed|29078353]
  • a ''[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB] [gene|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|rnhC]'' double mutant grows poorly [Pubmed|23882084]
  • a ''[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB] [gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]'' mutant is not viable [Pubmed|23882084]
  • The protein

    Catalyzed reaction/ biological activity

  • incises DNA-RNA duplexes at aingle rNMPs [pubmed|29078353]
  • removal of single rNMPs incorporated into DNA by DNA polymerase during [SW|DNA replication] [Pubmed|23882084]
  • Protein family

  • [SW|RNase] HII family (according to Swiss-Prot)
  • [SW|Cofactors]

  • Mg2+, Mn2+ [pubmed|29084857]
  • Structure

  • [PDB|2ETJ] (from Thermotoga maritima, corresponding to aa 69 ... 250, 47% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials


  • BP423 (''ΔrnhB::aphA3'') available in [SW|Fabian Commichau]'s lab
  • BKE16060 (Δ[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTCTCTTCTCCCTTAC, downstream forward: _UP4_TAAATCACCATGGACAAGGA
  • BKK16060 (Δ[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTCTCTTCTCCCTTAC, downstream forward: _UP4_TAAATCACCATGGACAAGGA
  • Expression vector

  • for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], based on [SW|pGP380], expression from plasmid: pBP500 (E. coli amp & B. subtilis E/L) , available in [SW|Fabian Commichau]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Fabian Commichau]'s lab
  • References


  • 19228197,24464998
  • Original publications

  • 9888800,10094689,12417313,17905985,23882084,26577401,29078353,29084857