SubtiBank SubtiBank
rnhB
The papers of the month are back! Check them out! Link here

rnhB

RNase HII, endoribonuclease, responsible for removal of single rNMPs incorporated into DNA by DNA polymerase during DNA replication
locus
BSU16060
pI
5.52
mw
28.20 kDa
protein length
255 aa Sequence Blast
gene length
765 bp Sequence Blast
function
endonucleolytic cleavage of RNA in RNA-DNA hybrid molecules
product
RNase HII
essential
no
ec
3.1.26.4
synonyms
rnh

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.1|DNA replication]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.2|Endoribonucleases]
  • Gene

    Coordinates
    1,677,451 → 1,678,218

    Phenotypes of a mutant

  • increased mutation rate [Pubmed|23882084], strand- and sequence-context–dependent GC → AT transitions [pubmed|29078353]
  • a ''[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB] [gene|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|rnhC]'' double mutant grows poorly [Pubmed|23882084]
  • a ''[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB] [gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]'' mutant is not viable [Pubmed|23882084]
  • The protein

    Catalyzed reaction/ biological activity

  • incises DNA-RNA duplexes at aingle rNMPs [pubmed|29078353]
  • removal of single rNMPs incorporated into DNA by DNA polymerase during [SW|DNA replication] [Pubmed|23882084]
  • Protein family

  • [SW|RNase] HII family (according to Swiss-Prot)
  • [SW|Cofactors]

  • Mg2+, Mn2+ [pubmed|29084857]
  • Structure

  • [PDB|2ETJ] (from Thermotoga maritima, corresponding to aa 69 ... 250, 47% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB]-[gene|0D4A4A1B2FD9D0698D0A65010A8ABC84DA7386A2|ylqG]-[gene|3F271D9FFE4F30D845319CD71662695AA592EC8F|ylqH]
    description
    [Pubmed|26577401]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • BP423 (''ΔrnhB::aphA3'') available in [SW|Fabian Commichau]'s lab
  • BKE16060 (Δ[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTCTCTTCTCCCTTAC, downstream forward: _UP4_TAAATCACCATGGACAAGGA
  • BKK16060 (Δ[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTCTCTTCTCCCTTAC, downstream forward: _UP4_TAAATCACCATGGACAAGGA
  • Expression vector

  • for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], based on [SW|pGP380], expression from plasmid: pBP500 (E. coli amp & B. subtilis E/L) , available in [SW|Fabian Commichau]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Fabian Commichau]'s lab
  • References

    Reviews

  • 19228197,24464998
  • Original publications

  • 9888800,10094689,12417313,17905985,23882084,26577401,29078353,29084857