SubtiBank SubtiBank
rnhB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rnhB

RNase HII, endoribonuclease, responsible for removal of single rNMPs incorporated into DNA by DNA polymerase during DNA replication
locus
BSU_16060
pI
5.52
mw
28.20 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast
function
endonucleolytic cleavage of RNA in RNA-DNA hybrid molecules
product
RNase HII
essential
no
ec
3.1.26.4
synonyms
rnh

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.1|DNA replication]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.2|Endoribonucleases]
  • Gene

    Coordinates
    1,677,451 → 1,678,218

    Phenotypes of a mutant

  • increased mutation rate [Pubmed|23882084], strand- and sequence-context–dependent GC → AT transitions [pubmed|29078353]
  • a ''[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB] [gene|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|rnhC]'' double mutant grows poorly [Pubmed|23882084]
  • a ''[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB] [gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]'' mutant is not viable [Pubmed|23882084]
  • The protein

    Catalyzed reaction/ biological activity

  • Endonucleolytic cleavage to 5'-phosphomonoester (according to UniProt)
  • incises DNA-RNA duplexes at aingle rNMPs [pubmed|29078353]
  • removal of single rNMPs incorporated into DNA by DNA polymerase during [SW|DNA replication] [Pubmed|23882084]
  • Protein family

  • [SW|RNase] HII family (with [protein|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|RnhC], according to UniProt)
  • [SW|Cofactors]

  • Mg2+, Mn2+ [pubmed|29084857]
  • Structure

  • [PDB|2ETJ] (from Thermotoga maritima, corresponding to aa 69 ... 250, 47% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB]-[gene|0D4A4A1B2FD9D0698D0A65010A8ABC84DA7386A2|ylqG]-[gene|3F271D9FFE4F30D845319CD71662695AA592EC8F|ylqH]
    description
    [Pubmed|26577401]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    genes
    [gene|54CD247926F7FABE4ACE85EB7021B62500B47260|rbgA]-[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB]-[gene|0D4A4A1B2FD9D0698D0A65010A8ABC84DA7386A2|ylqG]-[gene|3F271D9FFE4F30D845319CD71662695AA592EC8F|ylqH]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BP423 (''ΔrnhB::aphA3'') available in [SW|Fabian Commichau]'s lab
  • BKE16060 (Δ[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTCTCTTCTCCCTTAC, downstream forward: _UP4_TAAATCACCATGGACAAGGA
  • BKK16060 (Δ[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTCTCTTCTCCCTTAC, downstream forward: _UP4_TAAATCACCATGGACAAGGA
  • Expression vectors

  • for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], based on [SW|pGP380], expression from plasmid: pBP500 (E. coli amp & B. subtilis E/L) , available in [SW|Fabian Commichau]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Fabian Commichau]'s lab
  • References

    Reviews

  • 19228197,24464998,31464530
  • Original publications

  • 9888800,10094689,12417313,17905985,23882084,26577401,29078353,29084857