SubtiBank SubtiBank
cotI
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cotI

outer spore coat protein
locus
BSU_30920
pI
4.99
mw
41.09 kDa
protein length
357 aa Sequence Blast
gene length
1074 bp Sequence Blast
function
spore envelope
product
outer spore coat protein
essential
no
synonyms
ytaA

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    3,162,084 → 3,163,157

    The protein

    Protein family

  • cotS family (with [protein|DC99E507696A1CB23140A1CBA45DA07D1F7C7D53|CotS] and [protein|0F40291BB10DB6D7DFD94B9C7D700F4410C4EE69|YutH], according to UniProt)
  • Structure

  • [PDB|2Q83] [pubmed|20077512]
  • [SW|Localization]

  • outer spore coat [pubmed|28870294]
  • Expression and Regulation

    Operons

    genes
    [gene|D57116C65FD11EF92FB5D2945B10A1D024AEFF22|cotI]
    description
    [Pubmed|12480901]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,12480901], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,12480901]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A030 (ytaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/30 NBRP B. subtilis, Japan]
  • BKE30920 (Δ[gene|D57116C65FD11EF92FB5D2945B10A1D024AEFF22|cotI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTACCTGTTTTACTC, downstream forward: _UP4_TAAGACCATCATTTCCCCCG
  • BKK30920 (Δ[gene|D57116C65FD11EF92FB5D2945B10A1D024AEFF22|cotI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTACCTGTTTTACTC, downstream forward: _UP4_TAAGACCATCATTTCCCCCG
  • References

  • 12562816,15699190,12480901,20077512,28870294