SubtiBank SubtiBank
yocR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yocR

similar to sodium-dependent transporter
locus
BSU_19340
pI
9.59
mw
48.17 kDa
protein length
445 aa Sequence Blast
gene length
1338 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,104,934 → 2,106,271

    The protein

    Protein family

  • sodium:neurotransmitter symporter (SNF) (TC 2.A.22) family (with [protein|FF16BA2B744E89AADB00F936B9A50A82726312A7|YhdH], according to UniProt)
  • Paralogous protein(s)

  • [protein|FF16BA2B744E89AADB00F936B9A50A82726312A7|YhdH]
  • Structure

  • [PDB|4US4] (the protein from ''B. halodurans'', 45% identity, 77% similarity) [Pubmed|25282149]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|D5A30C841A142B49C50A38936802D0F60485DD7C|yocR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B419 (yocR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1418 NBRP B. subtilis, Japan]
  • BKE19340 (Δ[gene|D5A30C841A142B49C50A38936802D0F60485DD7C|yocR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCGTATCACTCCTATTTG, downstream forward: _UP4_TAACACACGAAGCCCCCGAG
  • BKK19340 (Δ[gene|D5A30C841A142B49C50A38936802D0F60485DD7C|yocR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCGTATCACTCCTATTTG, downstream forward: _UP4_TAACACACGAAGCCCCCGAG
  • References

  • 18763711,25282149