SubtiBank SubtiBank
yobD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yobD

similar to transcription regulator (Xre family)
locus
BSU_18850
pI
9.15
mw
12.83 kDa
protein length
112 aa Sequence Blast
gene length
339 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    2,056,278 → 2,056,616

    The protein

    Protein family

  • [SW|Xre family]
  • [SW|Domains]

  • [SW|HTH cro/C1-type domain] (aa 6-60) (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-B403 (yobD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1402 NBRP B. subtilis, Japan]
  • BKE18850 (Δ[gene|D600D3F369E9EB8BF49D17BFD0D813BFD114F6B0|yobD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGAATAAATGCCTCC, downstream forward: _UP4_TAAAAAAGCCCTCATAAGGG
  • BKK18850 (Δ[gene|D600D3F369E9EB8BF49D17BFD0D813BFD114F6B0|yobD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGAATAAATGCCTCC, downstream forward: _UP4_TAAAAAAGCCCTCATAAGGG
  • References

  • 23504016