SubtiBank SubtiBank
cypX
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cypX

cytochrome P450, cyclo-l-leucyl-l-leucyl dipeptide oxidase
locus
BSU_35060
pI
5.31
mw
45.31 kDa
protein length
405 aa Sequence Blast
gene length
1218 bp Sequence Blast
function
biosynthesis of the extracellular iron chelator pulcherrimin
product
cytochrome P450, cyclo-l-leucyl-l-leucyl dipeptide oxidase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.3|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.1|Acquisition of iron / Other]
  • Gene

    Coordinates
    3,602,588 → 3,603,805

    The protein

    Catalyzed reaction/ biological activity

  • implicated in the three-step oxidative transformation of the diketopiperazine cyclo-l-leucyl-l-leucyl into pulcherriminic acid [Pubmed|20690619]
  • cyclo(L-leucyl-L-leucyl) + 4 H+ + 3 O2 + 6 reduced [2Fe-2S]-[ferredoxin] --> 4 H2O + 6 oxidized [2Fe-2S]-[ferredoxin] + pulcherriminic acid (according to UniProt)
  • Protein family

  • [SW|cytochrome P450] family (according to UniProt)
  • Structure

  • [PDB|3NC3] [Pubmed|20690619]
  • Expression and Regulation

    Operons

    genes
    [gene|BCE1D8CDDF07396583FF50C4C192785545244BE2|yvmC]-[gene|D63EDBB6AA33708E8352F6208A9BA18CAEE0DC53|cypX]
    description
    [http://www.liebertonline.com/doi/pdf/10.1089/ind.2006.2.66 Reference]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|0D555F2AB7DC863E6FF388888308E980514DB719|PchR]: repression, in [regulon|0D555F2AB7DC863E6FF388888308E980514DB719|PchR regulon]
  • regulation

  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A333 (cypX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/333 NBRP B. subtilis, Japan]
  • BKE35060 (Δ[gene|D63EDBB6AA33708E8352F6208A9BA18CAEE0DC53|cypX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGGCTCATGTTTTACTCCC, downstream forward: _UP4_TAATAGAATTCCAAAGGTCT
  • BKK35060 (Δ[gene|D63EDBB6AA33708E8352F6208A9BA18CAEE0DC53|cypX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGGCTCATGTTTTACTCCC, downstream forward: _UP4_TAATAGAATTCCAAAGGTCT
  • References

  • 20690619,20817675,4204912,27542896