SubtiBank SubtiBank
capC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

capC

capsular polyglutamate biosynthesis
locus
BSU_35890
pI
9.67
mw
16.16 kDa
protein length
149 aa Sequence Blast
gene length
450 bp Sequence Blast
function
capsule synthesis
product
unknown
essential
no
synonyms
ywtA,pgsC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.4|Capsule biosynthesis and degradation]
  • Gene

    Coordinates
    3,698,982 → 3,699,431

    Phenotypes of a mutant

  • no synthesis of the poly-gamma-glutamate capsule [Pubmed|11751809]
  • Expression and Regulation

    Operons

    genes
    [gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]
    description
    [Pubmed|11751809]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19420703], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|19734658], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • additional information

  • expression of the operon is increased in '[protein|search|motA]' or '[protein|search|motB]' mutants due to increased [protein|search|DegU] phosphorylation [PubMed|24296669]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A076 (ywtA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/76 NBRP B. subtilis, Japan]
  • BKE35890 (Δ[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCGAACATGTCTGCATTTC, downstream forward: _UP4_ATTTAATGTAAGGTGTGTCA
  • BKK35890 (Δ[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCGAACATGTCTGCATTTC, downstream forward: _UP4_ATTTAATGTAAGGTGTGTCA
  • References

    Reviews

  • 20735481,16689787,29215550
  • Original publications

  • 11751809,19420703,16233197,20564357,20564574,24296669,21965392,27073802,29971620,30295732