SubtiBank SubtiBank
yydF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yydF

secreted peptide, controls [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]-[protein|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|LiaS] activity
locus
BSU_40180
pI
9.57
mw
5.65 kDa
protein length
gene length
150 bp Sequence Blast
function
control of [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]-[protein|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|LiaS] activity
product
secreted peptide
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    4,127,498 → 4,127,647

    The protein

    Modification

  • modified (epimerization of Val-36 and Ile-44 to the D-forms) by the radical SAM epimerase [protein|25FC87037222084ABE318813959101016FEB49DF|YydG] [Pubmed|28644475,23106164]
  • processing to the mature modified peptide (epipeptide) by the membrane protease [protein|E280A5994F4D9D93DA4B698E79C86360DBEE5396|YydH] [pubmed|28644475]
  • [SW|Localization]

  • extracellular (processing requires [protein|E280A5994F4D9D93DA4B698E79C86360DBEE5396|YydH], transport by [protein|1BF1A48CF645249CA9ECBB19C04B059B11D821EF|YydI]-[protein|A4213DE6C9BE29405B0A4C0A969A78EA4C5EB71F|YydJ]) [Pubmed|23106164]
  • Expression and Regulation

    Operons

    genes
    [gene|D66B9BFF79ADD8B0F9BFA3892FCF4597264CE9EE|yydF]-[gene|25FC87037222084ABE318813959101016FEB49DF|yydG]-[gene|E280A5994F4D9D93DA4B698E79C86360DBEE5396|yydH]-[gene|1BF1A48CF645249CA9ECBB19C04B059B11D821EF|yydI]-[gene|A4213DE6C9BE29405B0A4C0A969A78EA4C5EB71F|yydJ]
    description
    [Pubmed|17921301]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17921301], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|17921301], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • regulation

  • activated after transition to stationary phase([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|17921301]
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • the [gene|D66B9BFF79ADD8B0F9BFA3892FCF4597264CE9EE|yydF] portion of the mRNA belongs to the most stable mRNAs in B. subtilis [pubmed|17921301]
  • Biological materials

    Mutant

  • BKE40180 (Δ[gene|D66B9BFF79ADD8B0F9BFA3892FCF4597264CE9EE|yydF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATCCCTCCTCCTTT, downstream forward: _UP4_TAATTAGAGGGGTACAAAGG
  • BKK40180 (Δ[gene|D66B9BFF79ADD8B0F9BFA3892FCF4597264CE9EE|yydF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATCCCTCCTCCTTT, downstream forward: _UP4_TAATTAGAGGGGTACAAAGG
  • References

    Reviews

  • 23106164
  • Original publications

  • 12884008,17921301,17921301,21815947,23199363,28644475