SubtiBank SubtiBank
yabM
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yabM

may function in a previously observed alternate pathway for peptidoglycan strand synthesis
locus
BSU_00570
pI
9.62
mw
57.19 kDa
protein length
532 aa Sequence Blast
gene length
1599 bp Sequence Blast
function
alternate pathway for peptidoglycan strand synthesis
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    64,817 → 66,415

    Phenotypes of a mutant

  • Mutants lacking YabM exhibit sensitivity to moenomycin, an antibiotic that blocks peptidoglycan polymerization by class A [SW|penicillin-binding proteins] [Pubmed|19648239]
  • The protein

    Catalyzed reaction/ biological activity

  • may function in a previously observed alternate pathway for peptidoglycan strand synthesis [Pubmed|19648239]
  • Protein family

  • [SW|Polysaccharide synthase family] (according to UniProt)
  • [SW|MOP exporter family]
  • Paralogous protein(s)

  • [protein|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|MurJ], [protein|34A5CD28A3DBCB10B4E1C82E50143FA73B553919|YkvU], [protein|9633C40190B7D0EA264270FD44567C61A012AD15|SpoVB]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|D6B1837075ECBEE1FEAC704DDB6795336092897F|yabM]-[gene|52D48F22CB53421EE30970D34B4861E2F8A5893D|yabN]-[gene|B0CB19A3E3E84E12BF42BB050394C8A059A89359|yabO]-[gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]-[gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]-[gene|FE0E60B875E72AEF5174A89C7AE5556FF59B19D5|divIC]-[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]
    description
    [Pubmed|11283287]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,11283287], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|12207695], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • expressed during sporulation ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|11283287]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B914 (yabM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1913 NBRP B. subtilis, Japan]
  • BKE00570 (Δ[gene|D6B1837075ECBEE1FEAC704DDB6795336092897F|yabM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCAAAAGCTCCTTCCCA, downstream forward: _UP4_AAATTCATGAGAAGGAGAGA
  • BKK00570 (Δ[gene|D6B1837075ECBEE1FEAC704DDB6795336092897F|yabM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCAAAAGCTCCTTCCCA, downstream forward: _UP4_AAATTCATGAGAAGGAGAGA
  • References

  • 11283287,19648239,19666716