SubtiBank SubtiBank
rpmGA
The papers of the month are back! Check them out! Link here

rpmGA

ribosomal protein L33a
locus
BSU24900
pI
10.44
mw
5.85 kDa
protein length
gene length
147 bp Sequence Blast
function
translation
product
ribosomal protein L33a
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    2,574,408 → 2,574,557

    The protein

    Protein family

  • [SW|ribosomal protein] L33P family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|BBD82B93D5E880AB7093ED53DDB149B0E0B3BAE4|RpmGB], [protein|5189DF2F6144CD2429B5C01B1AD03BAE98307579|RpmGC]
  • Modification

  • phosphorylated on Arg-29 [Pubmed|22517742]
  • [SW|Cofactors]

  • requires zinc for activity [Pubmed|19648245]
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • Additional information

  • the protein is significantly underrepresented in 45S assembly intermediates that accumulate upon depletion of [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA] [Pubmed|24335279,23700310]
  • Expression and Regulation

    Operons

    genes
    [gene|D73FC9CAD929919050837824B4794F9FC9E83052|rpmGA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE24900 (Δ[gene|D73FC9CAD929919050837824B4794F9FC9E83052|rpmGA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTTCCCTCCAAACT, downstream forward: _UP4_TAACAGCTTTGCTGTTTGAG
  • BKK24900 (Δ[gene|D73FC9CAD929919050837824B4794F9FC9E83052|rpmGA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTTCCCTCCAAACT, downstream forward: _UP4_TAACAGCTTTGCTGTTTGAG
  • References

  • 19648245,22517742,23002217,24335279,23700310,25903689