SubtiBank SubtiBank
ybaC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybaC

similar to proline iminopeptidase
locus
BSU_01140
pI
9.65
mw
36.74 kDa
protein length
318 aa Sequence Blast
gene length
957 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    134,171 → 135,127

    The protein

    Protein family

  • Peptidase S33 family (single member, according to UniProt)
  • Structure

  • [PDB|3WMR] (from Streptomyces halstedii, 25% identity) [pubmed|24530530]
  • Biological materials

    Mutant

  • MGNA-B944 (ybaC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1943 NBRP B. subtilis, Japan]
  • BKE01140 (Δ[gene|D74DCFAE414EEBBB79D200EC85905E76C51792F1|ybaC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATATTAACCCCTCGA, downstream forward: _UP4_TGATAGATCCTTGATAAATA
  • BKK01140 (Δ[gene|D74DCFAE414EEBBB79D200EC85905E76C51792F1|ybaC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATATTAACCCCTCGA, downstream forward: _UP4_TGATAGATCCTTGATAAATA
  • References

    Research papers

  • 24530530