SubtiBank SubtiBank
yflL
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yflL

acylphosphatase
locus
BSU_07640
pI
8.67
mw
10.18 kDa
protein length
gene length
276 bp Sequence Blast
function
unknown
product
acylphosphatase
essential
no
ec
3.6.1.7
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    837,735 → 838,010

    The protein

    Catalyzed reaction/ biological activity

  • acyl phosphate + H2O --> carboxylate + H+ + phosphate (according to UniProt)
  • Protein family

  • acylphosphatase family (single member, according to UniProt)
  • [SW|Domains]

  • Acylphosphatase-like domain (aa 3-90) (according to UniProt)
  • Structure

  • [PDB|2FHM] (from ''Bacillus Subtilis'', 100% identity)
  • [PDB|3BR8], [PDB|2FHM] [Pubmed|20447399]
  • Expression and Regulation

    Operons

    genes
    [gene|D7C46835B9984E2C5E375816F2BB16566202CF27|yflL]
    description
    [Pubmed|22383849]

    additional information

  • 'yflL' transcription occurs in antisense orientation as compared to the surrounding '[protein|B51ADFB53CA54309D866BB089502639E9571238B|Nos]-[protein|C2E28821689A07B9AA1B0BD5C84D856C04D83E95|YflK]' operon
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C334 (yflL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2332 NBRP B. subtilis, Japan]
  • BKE07640 (Δ[gene|D7C46835B9984E2C5E375816F2BB16566202CF27|yflL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAAACCACCTTTTC, downstream forward: _UP4_GGCCATCATCGATTTTCTAT
  • BKK07640 (Δ[gene|D7C46835B9984E2C5E375816F2BB16566202CF27|yflL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAAACCACCTTTTC, downstream forward: _UP4_GGCCATCATCGATTTTCTAT
  • References

  • 20447399