SubtiBank SubtiBank
yhaX
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yhaX

[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]-dependent sporulation protein
locus
BSU_09830
pI
8.07
mw
32.26 kDa
protein length
288 aa Sequence Blast
gene length
867 bp Sequence Blast
function
protection of the spore
product
spore coat protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.1|Class I]
  • Gene

    Coordinates
    1,056,702 → 1,057,568

    The protein

    Protein family

  • [SW|HAD superfamily] (according to UniProt)
  • Structure

  • [PDB|3DNP]
  • [SW|Localization]

  • spore coat (basement), localization depends on [protein|A25C1530DA7BB007A288E525404E9F775E219FE8|SpoIVA] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|D7DD685750AB2C3CCDE0A2EBBEE1C1B9F97F2BB7|yhaX]
    description
    [Pubmed|10498703]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15699190,12662922,15383836]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yhaZ]' and '[protein|search|yhaX]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A676 (yhaX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/676 NBRP B. subtilis, Japan]
  • BKE09830 (Δ[gene|D7DD685750AB2C3CCDE0A2EBBEE1C1B9F97F2BB7|yhaX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGAGATGTCCCCCTCCT, downstream forward: _UP4_TAAAAAAGCCGCTCGCGCCC
  • BKK09830 (Δ[gene|D7DD685750AB2C3CCDE0A2EBBEE1C1B9F97F2BB7|yhaX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGAGATGTCCCCCTCCT, downstream forward: _UP4_TAAAAAAGCCGCTCGCGCCC
  • References

    Reviews

  • 23202530,27227299
  • Original publications

  • 10498703,15699190,12662922,20525796,22171814,15383836