SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


O6-methylguanine-DNA methyltransferase
19.98 kDa
protein length
179 aa Sequence Blast
gene length
540 bp Sequence Blast
adaptive response to alkylative DNA damage
O6-methylguanine-DNA methyltransferase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • Gene

    204,351 → 204,890

    The protein

    Catalyzed reaction/ biological activity

  • 6-O-methyl-2'-deoxyguanosine in DNA + L-cysteinyl-[protein] --> 2'-deoxyguanosine in DNA + S-methyl-L-cysteinyl-[protein] (according to UniProt)
  • 4-O-methyl-thymidine in DNA + L-cysteinyl-[protein] --> thymidine in DNA + S-methyl-L-cysteinyl-[protein] (according to UniProt)
  • Protein family

  • MGMT family (with [protein|9492D341F54BE019B21C0BAF7465AD8F84CC6F23|Ogt], according to UniProt)
  • Structure

  • [PDB|4BHB] (from Mycobacterium tuberculosis, 42% identity) [pubmed|23564173]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2120677], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|0F8A564256A598DB3A36668FA0C984542FE1323F|AdaA]: positive regulation, in [regulon|0F8A564256A598DB3A36668FA0C984542FE1323F|AdaA regulon]
  • regulation

  • positive control by [protein|search|AdaA] [Pubmed|2120677]
  • view in new tab

    Biological materials


  • BKE01820 (Δ[gene|D7E4E4A95CFDB3CFCC7432B08653644AF6876CA1|adaB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGTAAAGACCAATAAAGGG, downstream forward: _UP4_TGAAAGTGAATCATCTATAA
  • BKK01820 (Δ[gene|D7E4E4A95CFDB3CFCC7432B08653644AF6876CA1|adaB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGTAAAGACCAATAAAGGG, downstream forward: _UP4_TGAAAGTGAATCATCTATAA
  • References


  • 22933559,24810496
  • Original publications

  • 2120677,23564173