SubtiBank SubtiBank
yugK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yugK

similar to NADH-dependent butanol dehydrogenase
locus
BSU_31360
pI
4.64
mw
43.25 kDa
protein length
390 aa Sequence Blast
gene length
1173 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,222,195 → 3,223,367

    The protein

    Protein family

  • iron-containing alcohol dehydrogenase family (with [protein|1E951C2B640966643D5F081159522CD1C51942C8|YugJ] and [protein|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|GbsB], according to UniProt)
  • Paralogous protein(s)

  • [protein|1E951C2B640966643D5F081159522CD1C51942C8|YugJ]
  • Structure

  • [PDB|1VLJ] (from Thermotoga Maritima 42% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|D81610C7CA2A92FCB1195591ACB613E7C1288F6B|yugK]
    description
    [Pubmed|9274030]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B548 (yugK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1547 NBRP B. subtilis, Japan]
  • BKE31360 (Δ[gene|D81610C7CA2A92FCB1195591ACB613E7C1288F6B|yugK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTAAAACCTCCAAATG, downstream forward: _UP4_TAAACCCAAAGGGCGGAATC
  • BKK31360 (Δ[gene|D81610C7CA2A92FCB1195591ACB613E7C1288F6B|yugK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTAAAACCTCCAAATG, downstream forward: _UP4_TAAACCCAAAGGGCGGAATC
  • References

    Reviews

  • 20924577
  • Original publications

  • 9274030
  • The corresponding protein in ''E. coli

  • 20543070,18211903