SubtiBank SubtiBank
gmuD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gmuD

phospho-beta-mannosidase
locus
BSU_05840
pI
5.73
mw
54.17 kDa
protein length
465 aa Sequence Blast
gene length
1398 bp Sequence Blast
function
glucomannan utilization
product
phospho-beta-mannosidase
essential
no
synonyms
ydhP

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.25|Utilization of glucomannan]
  • Gene

    Coordinates
    628,630 → 630,027

    The protein

    Catalyzed reaction/ biological activity

  • 6-phospho-β-D-glucosyl-(1→4)-D-glucose + H2O --> D-glucose + D-glucose 6-phosphate (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 1 family] (according to UniProt)
  • Structure

  • [PDB|4B3K] (from Streptococcus pyogenes, 50% identity) [pubmed|23275159]
  • Expression and Regulation

    Operons

    genes
    [gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]-[gene|44014896157718D3A6190DFDBD663C5CB9DA63FC|gmuA]-[gene|76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC|gmuC]-[gene|D8C81A8768E9C6B47B5E196B54DC2A3A8256E7E6|gmuD]-[gene|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]-[gene|EB6DE119E6FB18413DB2C2B62B114FB787164F74|gmuE]-[gene|35225776F6044513D3E77DBBD6A7A8FE976F506A|gmuF]-[gene|289ACC9D13BBFAA5C083EE525ECCC32DB06E075F|gmuG]
    description
    [Pubmed|18177310]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18177310], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]: repression, [Pubmed|18177310], in [regulon|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|18177310], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by cellobiose ([protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]) [Pubmed|18177310]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C191 (ydhP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2189 NBRP B. subtilis, Japan]
  • BKE05840 (Δ[gene|D8C81A8768E9C6B47B5E196B54DC2A3A8256E7E6|gmuD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCCAAGTCTCTCTCCCCTT, downstream forward: _UP4_TAGATTTTCCTAAAGGTCAA
  • BKK05840 (Δ[gene|D8C81A8768E9C6B47B5E196B54DC2A3A8256E7E6|gmuD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCCAAGTCTCTCTCCCCTT, downstream forward: _UP4_TAGATTTTCCTAAAGGTCAA
  • References

  • 14652714,18177310,15139916,10627040,20817675,23275159