SubtiBank SubtiBank
ydcA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydcA

unknown
locus
BSU_04610
pI
9.30
mw
22.40 kDa
protein length
199 aa Sequence Blast
gene length
600 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    515,016 → 515,615

    The protein

    Protein family

  • [SW|peptidase S54 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|89C51789FBB2EE86771ABD8629FD99748ED5D4EF|YqgP]: [SW|peptidase S54 family]
  • [SW|Localization]

  • membrane (according to SwissProt)
  • Expression and Regulation

    Operons

    genes
    [gene|D941248711FEB7F3698AF7B02EED95722605CF72|ydcA]
    description
    [Pubmed|12662922]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C121 (ydcA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2119 NBRP B. subtilis, Japan]
  • BKE04610 (Δ[gene|D941248711FEB7F3698AF7B02EED95722605CF72|ydcA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGAGCCCCTTTTCTT, downstream forward: _UP4_TAACCGCCGCTTCAGATTGT
  • BKK04610 (Δ[gene|D941248711FEB7F3698AF7B02EED95722605CF72|ydcA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGAGCCCCTTTTCTT, downstream forward: _UP4_TAACCGCCGCTTCAGATTGT
  • References

  • 12662922