SubtiBank SubtiBank
yusZ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yusZ

putative short-chain acyl dehydrogenase
locus
BSU_32980
pI
9.17
mw
30.64 kDa
protein length
280 aa Sequence Blast
gene length
843 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yvxA

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,382,633 → 3,383,475

    The protein

    Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B7B1D28E50244704324920E5A6F110DA8D63F6C0|YxjF]
  • [SW|Cofactors]

  • FMN or FAD [Pubmed|21635694]
  • Structure

  • [PDB|3M1A] (from ''Streptomyces avemitilis'', 35% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|D945CAD7209CB94A7B9E23263476124B7E8853DD|yusZ]-[gene|68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B|mrgA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B210 (yusZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1209 NBRP B. subtilis, Japan]
  • BKE32980 (Δ[gene|D945CAD7209CB94A7B9E23263476124B7E8853DD|yusZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTAACCCTCCTATTAA, downstream forward: _UP4_TGATCTAAATTATAATTATT
  • BKK32980 (Δ[gene|D945CAD7209CB94A7B9E23263476124B7E8853DD|yusZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTAACCCTCCTATTAA, downstream forward: _UP4_TGATCTAAATTATAATTATT