SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative short-chain acyl dehydrogenase
30.64 kDa
protein length
280 aa Sequence Blast
gene length
843 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    3,382,633 → 3,383,475

    The protein

    Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B7B1D28E50244704324920E5A6F110DA8D63F6C0|YxjF]
  • [SW|Cofactors]

  • FMN or FAD [Pubmed|21635694]
  • Structure

  • [PDB|3M1A] (from ''Streptomyces avemitilis'', 35% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B210 (yusZ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32980 (Δ[gene|D945CAD7209CB94A7B9E23263476124B7E8853DD|yusZ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTAACCCTCCTATTAA, downstream forward: _UP4_TGATCTAAATTATAATTATT
  • BKK32980 (Δ[gene|D945CAD7209CB94A7B9E23263476124B7E8853DD|yusZ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTAACCCTCCTATTAA, downstream forward: _UP4_TGATCTAAATTATAATTATT