SubtiBank SubtiBank
ycgE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycgE

similar to transcription regulator
locus
BSU_03080
pI
8.45
mw
17.10 kDa
protein length
155 aa Sequence Blast
gene length
465 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    334,092 → 334,556

    Expression and Regulation

    Operons

    genes
    [gene|D948867BAEF91943250714453A474B90AB64E523|ycgE]-[gene|78B3F9580DED32469ACF537F4B40C7DBF0D4D995|ycgF]-[gene|CBEC4D299232FC5FCB57211525404CBD42D5AF68|ycgG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C049 (ycgE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2047 NBRP B. subtilis, Japan]
  • BKE03080 (Δ[gene|D948867BAEF91943250714453A474B90AB64E523|ycgE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTGACAGTCCTCCCTAT, downstream forward: _UP4_TAAGTGAATTTGTGCATAGC
  • BKK03080 (Δ[gene|D948867BAEF91943250714453A474B90AB64E523|ycgE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTGACAGTCCTCCCTAT, downstream forward: _UP4_TAAGTGAATTTGTGCATAGC