SubtiBank SubtiBank
yvaC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvaC

unknown
locus
BSU_33550
pI
10.06
mw
69.25 kDa
protein length
631 aa Sequence Blast
gene length
1896 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    3,446,237 → 3,448,132

    The protein

    Protein family

  • YccS/YhfK family (single member, according to UniProt)
  • Biological materials

    Mutant

  • MGNA-A445 (yvaC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/445 NBRP B. subtilis, Japan]
  • 1A643 ( ''yvaC''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A643&Search=1A643 BGSC]
  • BKE33550 (Δ[gene|D97126757CFEA6068705D35CC041094876ADA553|yvaC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGACAAAATCCTTTTC, downstream forward: _UP4_TAAGCTGTTTGGGAAAGTTA
  • BKK33550 (Δ[gene|D97126757CFEA6068705D35CC041094876ADA553|yvaC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGACAAAATCCTTTTC, downstream forward: _UP4_TAAGCTGTTTGGGAAAGTTA