SubtiBank SubtiBank
tdk
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tdk

thymidine kinase
locus
BSU_37060
pI
5.69
mw
21.30 kDa
protein length
195 aa Sequence Blast
gene length
588 bp Sequence Blast
function
biosynthesis of thymidine nucleotides
product
thymidine kinase (ATP:thymidine)
essential
no
ec
2.7.1.21
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    Coordinates
    3,802,405 → 3,802,992

    The protein

    Catalyzed reaction/ biological activity

  • ATP + thymidine --> ADP + dTMP + H+ (according to UniProt)
  • Protein family

  • thymidine kinase family (single member, according to UniProt)
  • Structure

  • [PDB|2JA1] (from B. cereus, 69% identity) [pubmed|17288553]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials

    Mutant

  • BKE37060 (Δ[gene|D97D4CFDF7A9A48A8764738ECFD42F1D3A900BE7|tdk]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGCTTCGCTCCCCTCT, downstream forward: _UP4_TAGTCCAAAACATGGGTATA
  • BKK37060 (Δ[gene|D97D4CFDF7A9A48A8764738ECFD42F1D3A900BE7|tdk]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGCTTCGCTCCCCTCT, downstream forward: _UP4_TAGTCCAAAACATGGGTATA
  • References

    Research papers

  • 17288553