SubtiBank SubtiBank
spoIIB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spoIIB

spatial and temporal regulation of the dissolution of septal peptidoglycan during engulfment
locus
BSU_28060
pI
4.80
mw
35.77 kDa
protein length
332 aa Sequence Blast
gene length
999 bp Sequence Blast
function
spore morphogenesis
product
facilitator of septal dissolution
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • Gene

    Coordinates
    2,863,294 → 2,864,292

    The protein

    [SW|Domains]

  • SPOR domain (aa 175-250) (according to UniProt)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|D98D61CA651AAA415386B1B2B41562E5CF77DEF1|spoIIB]
    description
    [Pubmed|12107147]

    sigma factors

  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulation

  • expression is reduced in a [protein|search|SigV] mutant [Pubmed|21926231]
  • view in new tab

    Biological materials

    Mutant

  • BKE28060 (Δ[gene|D98D61CA651AAA415386B1B2B41562E5CF77DEF1|spoIIB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCCGCTTCCTCCCTTC, downstream forward: _UP4_TAAGAGATAGTGCCCTGAGC
  • BKK28060 (Δ[gene|D98D61CA651AAA415386B1B2B41562E5CF77DEF1|spoIIB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCCGCTTCCTCCCTTC, downstream forward: _UP4_TAAGAGATAGTGCCCTGAGC
  • References

  • 17376078,8419299,7559352,12107147