SubtiBank SubtiBank
bioD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

bioD

dethiobiotin synthase
locus
BSU_30210
pI
6.21
mw
25.01 kDa
protein length
231 aa Sequence Blast
gene length
696 bp Sequence Blast
function
biosynthesis of biotin
product
dethiobiotin synthase
essential
no
ec
6.3.3.3
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.1|Biosynthesis/ acquisition of biotin]
  • Gene

    Coordinates
    3,091,492 → 3,092,187

    The protein

    Catalyzed reaction/ biological activity

  • 7,8-diaminononanoate + ATP + CO2 = ADP + dethiobiotin + 3 H+ + phosphate (according to UniProt)
  • Protein family

  • dethiobiotin synthetase family (single member, according to UniProt)
  • Structure

  • [PDB|1DTS] (from E. coli, 32% identity) [pubmed|8081756]
  • Expression and Regulation

    Operons

    genes
    [gene|C40116089BAD3F9831F8C837DC4F2E045753ABDE|bioW]-[gene|68C86FED3575B864C576DFB73FE7B5BF83994D1F|bioA]-[gene|8B6A3E86A88928526D94FDA94B9C81ABF6E9ACFB|bioF]-[gene|D9A71DAF949FB6C9C22C8361D83C5A0741184977|bioD]-[gene|5880617EB95FC0D19219A868D6D0A3D1D0D9C532|bioB]-[gene|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|bioI]-[gene|089A32D08B5A7E552CBD9CB9745BD542863B4558|ytbQ]
    description
    [Pubmed|8763940,8892842]

    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|8763940,8892842], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|8763940,8892842]
  • view in new tab

    Biological materials

    Mutant

  • BKE30210 (Δ[gene|D9A71DAF949FB6C9C22C8361D83C5A0741184977|bioD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTTCCCGTCACAAAAAAAC, downstream forward: _UP4_ATGAATCAAGTGGGGGTATG
  • BKK30210 (Δ[gene|D9A71DAF949FB6C9C22C8361D83C5A0741184977|bioD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTTCCCGTCACAAAAAAAC, downstream forward: _UP4_ATGAATCAAGTGGGGGTATG
  • References

    Reviews

  • 21437340
  • Original publications

  • 8763940,8892842,8081756