SubtiBank SubtiBank
yneK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yneK

unknown
locus
BSU_17960
pI
9.66
mw
16.85 kDa
protein length
142 aa Sequence Blast
gene length
429 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yoxJ

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,924,993 → 1,925,421

    The protein

    [SW|Localization]

  • membrane, forms foci at the site of septation [Pubmed|23060960]
  • Expression and Regulation

    Operons

    genes
    [gene|D9D672A76DB6B179AFEB1B3661A5C2FDA9311188|yneK]
    description
    [Pubmed|9068642]

    additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yneK]' and '[protein|search|cotM]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B391 (yneK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1390 NBRP B. subtilis, Japan]
  • BKE17960 (Δ[gene|D9D672A76DB6B179AFEB1B3661A5C2FDA9311188|yneK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATCATTCCCCCTTAT, downstream forward: _UP4_TAAAAAACCTTTCCTGACAA
  • BKK17960 (Δ[gene|D9D672A76DB6B179AFEB1B3661A5C2FDA9311188|yneK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATCATTCCCCCTTAT, downstream forward: _UP4_TAAAAAACCTTTCCTGACAA
  • References

  • 9068642,20525796,23060960