SubtiBank SubtiBank
yqgE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yqgE

unknown
locus
BSU_25010
pI
10.07
mw
48.06 kDa
protein length
430 aa Sequence Blast
gene length
1293 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,584,035 → 2,585,327

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-C486 (yqgE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2484 NBRP B. subtilis, Japan]
  • BKE25010 (Δ[gene|D9F2049EC60BDB29EC358B867D05AE1E805B123E|yqgE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACTGACTCCCCTTTAC, downstream forward: _UP4_TAATTTTTTTGCCAAAAAGG
  • BKK25010 (Δ[gene|D9F2049EC60BDB29EC358B867D05AE1E805B123E|yqgE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACTGACTCCCCTTTAC, downstream forward: _UP4_TAATTTTTTTGCCAAAAAGG
  • References

  • 10960106