SubtiBank SubtiBank
ylbA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ylbA

unknown
locus
BSU_14940
pI
4.98
mw
13.35 kDa
protein length
120 aa Sequence Blast
gene length
363 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,565,347 → 1,565,709

    The protein

    Structure

  • [PDB|2R5X] (from Geobacillus kaustophilus, 53% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|DA07722C01A96CCB5A2A6DC6899D0D86C791A3E7|ylbA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B358 (ylbA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1357 NBRP B. subtilis, Japan]
  • BKE14940 (Δ[gene|DA07722C01A96CCB5A2A6DC6899D0D86C791A3E7|ylbA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGACCCCTCCTTATAAA, downstream forward: _UP4_TAACGAAAAGGTACAGCATA
  • BKK14940 (Δ[gene|DA07722C01A96CCB5A2A6DC6899D0D86C791A3E7|ylbA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGACCCCTCCTTATAAA, downstream forward: _UP4_TAACGAAAAGGTACAGCATA
  • References

  • 20817675