SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


membrane protein, part of the type VII protein secretion system [protein|3CC3E197848E9688413C15CEA7DDCF0A7120A920|YukD]-[protein|3FE4A91C7D0B43C8704391F2F9493852B3AED9B0|YukC]-[protein|6007664F3D979B4D8D4662C7F6E5CF2F489268E3|YukB]-[protein|0A38B2E900532C9950DE6E629F5EB21D64E18B55|YueB]-[protein|DA52C4CD130F32734E01A52F2F395127D2260F61|YueC]
16.77 kDa
protein length
151 aa Sequence Blast
gene length
456 bp Sequence Blast
export of [protein|50D2A03E2D7B5D461540FD157377E0D37F771888|YukE]
part of the type VII protein secretion system

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,266,200 → 3,266,655

    Phenotypes of a mutant

  • loss of secretion of [protein|50D2A03E2D7B5D461540FD157377E0D37F771888|YukE] [Pubmed|24798022]
  • The protein

    Protein family

  • EssA family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt) [Pubmed|23861817]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|23861817], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expressed in the stationary phase [Pubmed|23861817]
  • view in new tab

    Biological materials


  • MGNA-A648 (yueC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE31850 (Δ[gene|DA52C4CD130F32734E01A52F2F395127D2260F61|yueC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAATCATGATCCCCT, downstream forward: _UP4_TAGGCCGCGTGCTTGTGTTG
  • BKK31850 (Δ[gene|DA52C4CD130F32734E01A52F2F395127D2260F61|yueC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAATCATGATCCCCT, downstream forward: _UP4_TAGGCCGCGTGCTTGTGTTG
  • References


  • 19155186,11973144
  • Original publications

  • 22383849,23861817,24798022