SubtiBank SubtiBank
ydfL
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydfL

similar to multidrug-efflux transporter regulator ([SW|MerR family])
locus
BSU_05460
pI
6.62
mw
31.63 kDa
protein length
270 aa Sequence Blast
gene length
813 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    594,186 → 594,998

    The protein

    Protein family

  • [SW|MerR family]
  • [SW|Domains]

  • [SW|HTH merR-type domain] (aa 4-74) (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-C151 (ydfL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2149 NBRP B. subtilis, Japan]
  • BKE05460 (Δ[gene|DAB54DCDE7FFB762EF421FF5FC4804EC0C3B6FD3|ydfL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAACAACCTTTCTGT, downstream forward: _UP4_TAATCTCATGAATATGTTTT
  • BKK05460 (Δ[gene|DAB54DCDE7FFB762EF421FF5FC4804EC0C3B6FD3|ydfL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAACAACCTTTCTGT, downstream forward: _UP4_TAATCTCATGAATATGTTTT