SubtiBank SubtiBank
ydfL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydfL

similar to multidrug-efflux transporter regulator ([SW|MerR family])
locus
BSU_05460
pI
6.62
mw
31.63 kDa
protein length
270 aa Sequence Blast
gene length
813 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    594,186 → 594,998

    The protein

    Protein family

  • [SW|MerR family]
  • Biological materials

    Mutant

  • MGNA-C151 (ydfL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2149 NBRP B. subtilis, Japan]
  • BKE05460 (Δ[gene|DAB54DCDE7FFB762EF421FF5FC4804EC0C3B6FD3|ydfL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAACAACCTTTCTGT, downstream forward: _UP4_TAATCTCATGAATATGTTTT
  • BKK05460 (Δ[gene|DAB54DCDE7FFB762EF421FF5FC4804EC0C3B6FD3|ydfL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAACAACCTTTCTGT, downstream forward: _UP4_TAATCTCATGAATATGTTTT