SubtiBank SubtiBank
ywqN
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ywqN

unknown
locus
BSU_36150
pI
8.75
mw
20.33 kDa
protein length
181 aa Sequence Blast
gene length
546 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,722,786 → 3,723,331

    The protein

    Protein family

  • ssuE family (single member, according to UniProt)
  • Structure

  • [PDB|1RLI]
  • Expression and Regulation

    Operons

    genes
    [gene|DAB8C8C1FC80AA01294304E98CA6FF5A71B02715|ywqN]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A577 (ywqN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/577 NBRP B. subtilis, Japan]
  • BKE36150 (Δ[gene|DAB8C8C1FC80AA01294304E98CA6FF5A71B02715|ywqN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGCATCTGCTCCTTT, downstream forward: _UP4_TTACTGAAAAGAAGCGATGC
  • BKK36150 (Δ[gene|DAB8C8C1FC80AA01294304E98CA6FF5A71B02715|ywqN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGCATCTGCTCCTTT, downstream forward: _UP4_TTACTGAAAAGAAGCGATGC