SubtiBank SubtiBank
rpmEB
The papers of the month are back! Check them out! Link here

rpmEB

general stress protein, binds in the stationary phase to the ribosome, replaces RpmE under conditions of zinc limitation
locus
BSU30700
pI
9.81
mw
9.39 kDa
protein length
gene length
246 bp Sequence Blast
function
survival of salt stress
product
accessory ribosomal protein
essential
no
synonyms
rpmE2, ytiA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,138,978 → 3,139,226

    The protein

    Protein family

  • Type B subfamily (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|035154A4160F084BA1CC124D0951937B203E167D|RpmE]
  • Modification

  • phosphorylated on Arg-70 [Pubmed|22517742]
  • Expression and Regulation

    Operons

    genes
    [gene|DAE7AB27A4C42BF50556BB76F33BEFA8DF35EA3A|rpmEB]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]: repression, in the presence of zinc [PubMed|12904577,15049826], in [regulon|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A292 (ytiA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/292 NBRP B. subtilis, Japan]
  • BKE30700 (Δ[gene|DAE7AB27A4C42BF50556BB76F33BEFA8DF35EA3A|rpmEB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGTATCTCCTTTCAAT, downstream forward: _UP4_TAAGGCAGGCCTGAGGGTTT
  • BKK30700 (Δ[gene|DAE7AB27A4C42BF50556BB76F33BEFA8DF35EA3A|rpmEB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGTATCTCCTTTCAAT, downstream forward: _UP4_TAAGGCAGGCCTGAGGGTTT
  • References

  • 17163968,15049826,16547061,12904577,22383849,15805528,19648245,22517742,23002217,27561249