SubtiBank SubtiBank
gcvPA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

gcvPA

glycine decarboxylase (subunit 1)
locus
BSU_24560
pI
6.95
mw
49.33 kDa
protein length
448 aa Sequence Blast
gene length
1347 bp Sequence Blast
function
glycine utilization
product
glycine decarboxylase (subunit 1)
essential
no
ec
1.4.4.2
synonyms
yqhJ,gcvP

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.8|Utilization of threonine/ glycine]
  • Gene

    Coordinates
    2,546,869 → 2,548,215

    The protein

    Catalyzed reaction/ biological activity

  • glycine + H+ + N6-lipoyl-L-lysyl-[glycine-cleavage complex H protein] --> (R)-N6-(S8-aminomethyldihydrolipoyl)-L-lysyl-[glycine-cleavage complex H protein] + CO2 (according to UniProt)
  • Protein family

  • GcvP family (with [protein|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|GcvPB], according to UniProt)
  • Structure

  • [PDB|1WYT] (the [protein|DB0618EBA12013842ED3972165D0276F438D8EC1|GcvPA]-[protein|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|GcvPB] complex from Thermus thermophilus, 56% identity) [pubmed|15791207]
  • Expression and Regulation

    Operons

    genes
    [gene|F6F449170276055E6D60D89E9E17A152A82CA166|gcvT]-[gene|DB0618EBA12013842ED3972165D0276F438D8EC1|gcvPA]-[gene|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB]
    description
    [Pubmed|15472076]

    regulatory mechanism

  • [regulon|Gly-box|Gly-box]: termination, [pubmed|31992591], in [regulon|Gly-box|Gly-box]
  • regulation

  • induced by glycine [Pubmed|15472076]
  • the [SW|Gly-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C415 (yqhJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2413 NBRP B. subtilis, Japan]
  • BKE24560 (Δ[gene|DB0618EBA12013842ED3972165D0276F438D8EC1|gcvPA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTTGTCTCCTCTCTC, downstream forward: _UP4_CTCATTCAGGAATTGGGGGA
  • BKK24560 (Δ[gene|DB0618EBA12013842ED3972165D0276F438D8EC1|gcvPA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTTGTCTCCTCTCTC, downstream forward: _UP4_CTCATTCAGGAATTGGGGGA
  • References

  • 12107147,15472076,15791207