SubtiBank SubtiBank
hutH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

hutH

histidase
locus
BSU_39350
pI
5.22
mw
55.51 kDa
protein length
508 aa Sequence Blast
gene length
1527 bp Sequence Blast
function
histidine utilization
product
histidase
essential
no
ec
4.3.1.3
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.5|Utilization of histidine]
  • Gene

    Coordinates
    4,042,051 → 4,043,577

    The protein

    Catalyzed reaction/ biological activity

  • L-histidine --> NH4+ + trans-urocanate (according to Swiss-Prot)
  • Protein family

  • PAL/histidase family (single member, according to UniProt)
  • Structure

  • [PDB|1B8F] (from ''Pseudomonas putida'', 43% identity, 62% similarity) [Pubmed|10220322]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]-[gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH]-[gene|ED6002BB56B96F9A2B4F80CA050518B266000E55|hutU]-[gene|BD3382760B704972A0E67ECEDA4B29AA4ECD8164|hutI]-[gene|FBB15E07B7134C57208EA82D5339708385DBC5FB|hutG]-[gene|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8071225], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8071225], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|8682780], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|HutP]: antitermination, at a protein-dependent [SW|RNA switch] located between [gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP] and [gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH] [Pubmed|8071225], in [regulon|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|HutP regulon]
  • regulation

  • induced by histidine ([protein|search|HutP]) [Pubmed|8071225]
  • view in new tab

    Biological materials

    Mutant

  • GP1114 (hutH::Tn10, spc), available in [SW|Stülke] lab
  • BKE39350 (Δ[gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGCCCAACTCCTTTTT, downstream forward: _UP4_AAAGAACTAAGGGGGATGAA
  • BKK39350 (Δ[gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGCCCAACTCCTTTTT, downstream forward: _UP4_AAAGAACTAAGGGGGATGAA
  • References

    Reviews

  • 22933560
  • Original publications

  • 10746760,6143742,8071225,8682780,10217782